PyroMark CpG Assays

Protocol tips

Upstream tips	Protocol tips	Downstream tips
For best results, the CT Conversion Reagent should be prepared freshly and used immediately following preparation.

Upstream tips
For best results, the CT Conversion Reagent should be prepared freshly and used immediately following preparation.

Publication protocol

Methylation analysis of retrotransposon LINE-1
The analysis of LINE-1 DNA methylation was performed identically as described previously in full detail [18]. Bisulfite treatment was performed using the EZ DNA Methylation-Gold Kit (Zymo Research, Freiburg, Germany) with 0.5–1 μg genomic DNA as instructed by the manufacturer.

The analyzed region of a CpG island located in the promoter region (L1Hs) DNA (PubMed GenBank X58075.1; lower strand) has the bisulfite-converted sequence 5′-TTTTGAGTTAGGTGTGGGATATAGTTTYGTGGTGYGTYGTTTTTTAAGTYGGTTTGAAAAGCTAATATTCGGGTGGGAGTGATTCGATTTTTTAGGTGCGTTCGTTATTTTTTTTTTTGATTCGGAAAGGGAATTTTTTGATTTT-3′ where the 146-bp PCR product contains four analyzed CpG methylation sites (bold) and annealing sites for the PCR primers (underlined) and the sequencing primer (italic), respectively [7, 52]. PCR reactions were run on a Mastercycler nexus gradient flexlid device (Eppendorf, Hamburg, Germany) in a 50-μl reaction volume including 5-μl bisulfite-treated DNA, mixed with 0.5 μl MyTaq™ HS DNA Polymerase (5 U/μl) (Bioline, Luckenwalde, Germany), 10 μl 5× MyTaq Reaction Buffer, 0.2 μl of each PCR primer (100 μM), and 34.1 μl HPLC-purified water. The following PCR program was used: 95 °C for 1 min, 40 amplification cycles at 95 °C for 15 s, 56 °C for 15 s, 72 °C for 15 s, and a final elongation step at 72 °C for 5 min.

The analysis of the global methylation marker LINE-1 was done by means of Pyrosquencing™ (Qiagen, Hilden, Germany) as described previously [7, 38, 52]. In brief, 50 μl of the PCR templates were processed and purified with the PyroMark Vacuum Prep Worktable (Biotage, Uppsala Sweden) and subsequently annealed to the sequencing primer (5′-AGTTAGGTGTGGGATATAGT-3′) at 80 °C for 2 min as instructed by the manufacturer.

Sequence analysis took place on a PSQ 96 MA System using the PyroMark Gold Q96 Reagents (Qiagen, Hilden, Germany) with the sequence to analyze TTYGTGGTGYGTYGTTTTTTAAGTYGGTTT. Pyro Q-CpG methylation software (version 1.0.9) had been used to determine the nucleotide dispensation order (ATCAGTGTGTCAGTCAGTCTAGTCTG). LINE-1 methylation values represent the mean percentage methylation across all four CpG sites, which were measured in duplicate samples within one run. In addition, each sample was measured in two independent runs, which were subsequently averaged.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing DNA methylation profiling Whole genome profiling - human whole blood using PyroMark CpG Assays from Qiagen.

Manufacturer protocol

Download the product protocol from Qiagen for PyroMark CpG Assays below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing DNA methylation profiling Whole genome profiling - human whole blood using PyroMark CpG Assays from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.