Found 735 results for siRNA / miRNA gene silencing.


Find the best product for any wet lab experiment Shared knowledge is peer reviewed Ask questions, get answers Toggle navigation Experiments Products Discussions   Login   Join for free Labettor RNA siRNA / miRNA gene silencing Human U937 HDAC5 siRNA / miRNA gene silencing Human - U937 HDAC5 Gene silencing through the use of small interfering RNA (siRNA) has become a primary tool for identifying disease-causing genes. There are several aspects for preparing and delivering effective siRNA to knockdown a target gene. The length of siRNA should be 21–23nt long with G/C content 30–50%. If a validated siRNA sequence for your target gene is not available, use siRNA generated against the entire target gene ORF. Always work with two or three different siRNA constructs to get reliable results. If you are not sure how much siRNA to use for a given experiment, start with a transfection concentration of 10-50 nM and use siRNA-specific transfection reagent to ensure efficient siRNA delivery in a wide range of cells. 1 Matching solution Start a discussion Start discussion No discussions found Start your discussion Share your thoughts or question with experts in your field Start a discussion Found 1 matching solution for this experiment Hs_HDAC5_4 FlexiTube siRNA Qiagen Upstream tips Protocol tips Downstream tips siRNA sequence: Sense CGGGUUUGAUGCUGUUGAATT AntiSense-UUCAACAGCAUCAAACCCGGC siRNA concentartion-120 pmol It is recommended to use HiPerFect Transfection Reagent for low-throughput siRNA transfection and HiPerFect HTS Reagent for high-throughput siRNA transfection. Protocol tips siRNA sequence: Sense CGGGUUUGAUGCUGUUGAATT AntiSense-UUCAACAGCAUCAAACCCGGC siRNA concentartion-120 pmol It is recommended to use HiPerFect Transfection Reagent for low-throughput siRNA transfection and HiPerFect HTS Reagent for high-throughput siRNA transfection. Publication protocol 1 Relevant paper Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product! Become shareholder Discussions About us Contact Privacy Terms

RNA siRNA / miRNA gene silencing Human U937 HDAC5

Find the best product for any wet lab experiment Shared knowledge is peer reviewed Ask questions, get answers Toggle navigation Experiments Products Discussions   Login   Join for free Labettor RNA siRNA / miRNA gene silencing Mouse RAW264.7 HDAC5 siRNA / miRNA gene silencing Mouse - RAW264.7 HDAC5 Gene silencing through the use of small interfering RNA (siRNA) has become a primary tool for identifying disease-causing genes. There are several aspects for preparing and delivering effective siRNA to knockdown a target gene. The length of siRNA should be 21–23nt long with G/C content 30–50%. If a validated siRNA sequence for your target gene is not available, use siRNA generated against the entire target gene ORF. Always work with two or three different siRNA constructs to get reliable results. If you are not sure how much siRNA to use for a given experiment, start with a transfection concentration of 10-50 nM and use siRNA-specific transfection reagent to ensure efficient siRNA delivery in a wide range of cells. 1 Matching solution Start a discussion Start discussion No discussions found Start your discussion Share your thoughts or question with experts in your field Start a discussion Found 1 matching solution for this experiment Mm_Hdac5_2 FlexiTube siRNA Qiagen Upstream tips Protocol tips Downstream tips MmHDAC5_2 S-GCCUCGGAACCCAACUUAATT AS UUAAGUUGGGUUCCGAGGCCG MmHDAC5_5 S-GGGCAAGAUCCUUACCAAATT AS-UUUGGUAAGGAUCUUGCCCAG HsHDAC5_1 SACGACACGUUCAUGCUAAATT AS-UUUAGCAUGAACGUGUCGUAG HsHDAC5_4 S-CGGGUUUGAUGCUGUUGAATT AS-UUCAACAGCAUCAAACCCGGC siRNA concentration-120 pmol Protocol tips MmHDAC5_2 S-GCCUCGGAACCCAACUUAATT AS UUAAGUUGGGUUCCGAGGCCG MmHDAC5_5 S-GGGCAAGAUCCUUACCAAATT AS-UUUGGUAAGGAUCUUGCCCAG HsHDAC5_1 SACGACACGUUCAUGCUAAATT AS-UUUAGCAUGAACGUGUCGUAG HsHDAC5_4 S-CGGGUUUGAUGCUGUUGAATT AS-UUCAACAGCAUCAAACCCGGC siRNA concentration-120 pmol Manufacturer protocol Publication protocol 1 Relevant paper Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product! Become shareholder Discussions About us Contact Privacy Terms

RNA siRNA / miRNA gene silencing Mouse RAW264.7 HDAC5

Find the best product for any wet lab experiment Shared knowledge is peer reviewed Ask questions, get answers Toggle navigation Experiments Products Discussions   Login   Join for free Labettor RNA siRNA / miRNA gene silencing Human MOLT4 RAG1 siRNA / miRNA gene silencing Human - MOLT4 RAG1 Gene silencing through the use of small interfering RNA (siRNA) has become a primary tool for identifying disease-causing genes. There are several aspects for preparing and delivering effective siRNA to knockdown a target gene. The length of siRNA should be 21–23nt long with G/C content 30–50%. If a validated siRNA sequence for your target gene is not available, use siRNA generated against the entire target gene ORF. Always work with two or three different siRNA constructs to get reliable results. If you are not sure how much siRNA to use for a given experiment, start with a transfection concentration of 10-50 nM and use siRNA-specific transfection reagent to ensure efficient siRNA delivery in a wide range of cells. 1 Matching solution Start a discussion Start discussion No discussions found Start your discussion Share your thoughts or question with experts in your field Start a discussion Found 1 matching solution for this experiment SASI_Hs01_00024301 Sigma-Aldrich Upstream tips Protocol tips Downstream tips 30 nM – 300 nM siRNA Protocol tips 30 nM – 300 nM siRNA Manufacturer protocol Publication protocol 1 Relevant paper Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product! Become shareholder Discussions About us Contact Privacy Terms

RNA siRNA / miRNA gene silencing Human MOLT4 RAG1

Find the best product for any wet lab experiment Shared knowledge is peer reviewed Ask questions, get answers Toggle navigation Experiments Products Discussions   Login   Join for free Labettor RNA siRNA / miRNA gene silencing Mouse RAW264.7 STAT3 siRNA / miRNA gene silencing Mouse - RAW264.7 STAT3 Gene silencing through the use of small interfering RNA (siRNA) has become a primary tool for identifying disease-causing genes. There are several aspects for preparing and delivering effective siRNA to knockdown a target gene. The length of siRNA should be 21–23nt long with G/C content 30–50%. If a validated siRNA sequence for your target gene is not available, use siRNA generated against the entire target gene ORF. Always work with two or three different siRNA constructs to get reliable results. If you are not sure how much siRNA to use for a given experiment, start with a transfection concentration of 10-50 nM and use siRNA-specific transfection reagent to ensure efficient siRNA delivery in a wide range of cells. 1 Matching solution Start a discussion Start discussion No discussions found Start your discussion Share your thoughts or question with experts in your field Start a discussion Found 1 matching solution for this experiment ON-TARGETplus Mouse Stat3 siRNA Dharmacon Upstream tips Protocol tips Downstream tips Post transfection with Amaxa Nucleofector, cells were incubated for 24h. Protocol tips Post transfection with Amaxa Nucleofector, cells were incubated for 24h. Manufacturer protocol Publication protocol 1 Relevant paper Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product! Become shareholder Discussions About us Contact Privacy Terms

RNA siRNA / miRNA gene silencing Mouse RAW264.7 STAT3

Find the best product for any wet lab experiment Shared knowledge is peer reviewed Ask questions, get answers Toggle navigation Experiments Products Discussions   Login   Join for free Labettor RNA siRNA / miRNA gene silencing Human K562 MYB siRNA / miRNA gene silencing Human - K562 MYB Gene silencing through the use of small interfering RNA (siRNA) has become a primary tool for identifying disease-causing genes. There are several aspects for preparing and delivering effective siRNA to knockdown a target gene. The length of siRNA should be 21–23nt long with G/C content 30–50%. If a validated siRNA sequence for your target gene is not available, use siRNA generated against the entire target gene ORF. Always work with two or three different siRNA constructs to get reliable results. If you are not sure how much siRNA to use for a given experiment, start with a transfection concentration of 10-50 nM and use siRNA-specific transfection reagent to ensure efficient siRNA delivery in a wide range of cells. 1 Matching solution Start a discussion Start discussion No discussions found Start your discussion Share your thoughts or question with experts in your field Start a discussion Found 1 matching solution for this experiment Accell Human MYB (4602) siRNA - SMARTpool Dharmacon Upstream tips Protocol tips Downstream tips Final concentration of 1 µM. Incubate TransIT-LT1 Reagent:siRNA complexe mixture at room temperature for 15–30 minutes to allow sufficient time for complexes to form and add to cells.  Incubate for 24–72 hours Protocol tips Final concentration of 1 µM. Incubate TransIT-LT1 Reagent:siRNA complexe mixture at room temperature for 15–30 minutes to allow sufficient time for complexes to form and add to cells.  Incubate for 24–72 hours Manufacturer protocol Publication protocol 1 Relevant paper Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product! Become shareholder Discussions About us Contact Privacy Terms

RNA siRNA / miRNA gene silencing Human K562 MYB

Find the best product for any wet lab experiment Shared knowledge is peer reviewed Ask questions, get answers Toggle navigation Experiments Products Discussions   Login   Join for free Labettor RNA siRNA / miRNA gene silencing Human DuCaP MID1 siRNA / miRNA gene silencing Human - DuCaP MID1 Gene silencing through the use of small interfering RNA (siRNA) has become a primary tool for identifying disease-causing genes. There are several aspects for preparing and delivering effective siRNA to knockdown a target gene. The length of siRNA should be 21–23nt long with G/C content 30–50%. If a validated siRNA sequence for your target gene is not available, use siRNA generated against the entire target gene ORF. Always work with two or three different siRNA constructs to get reliable results. If you are not sure how much siRNA to use for a given experiment, start with a transfection concentration of 10-50 nM and use siRNA-specific transfection reagent to ensure efficient siRNA delivery in a wide range of cells. 1 Matching solution Start a discussion Start discussion No discussions found Start your discussion Share your thoughts or question with experts in your field Start a discussion Found 1 matching solution for this experiment ON-TARGETplus Human MID1 (4281) siRNA - Individual Dharmacon Upstream tips Protocol tips Downstream tips MID1-3 siRNA: 5′-GUGUGAUACUAGGAUGCGG-3′ siRNA final concentration- 20 to 40 nM Add diluted siRNA to diluted Lipofectamine Reagent Incubate for 5 min at RT and add to cells. Incubate cells for 1–3 days at 37°C. Protocol tips MID1-3 siRNA: 5′-GUGUGAUACUAGGAUGCGG-3′ siRNA final concentration- 20 to 40 nM Add diluted siRNA to diluted Lipofectamine Reagent Incubate for 5 min at RT and add to cells. Incubate cells for 1–3 days at 37°C. Manufacturer protocol Publication protocol 1 Relevant paper Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product! Become shareholder Discussions About us Contact Privacy Terms

RNA siRNA / miRNA gene silencing Human DuCaP MID1

Find the best product for any wet lab experiment Shared knowledge is peer reviewed Ask questions, get answers Toggle navigation Experiments Products Discussions   Login   Join for free Labettor RNA siRNA / miRNA gene silencing Human RWPE SKIL siRNA / miRNA gene silencing Human - RWPE SKIL Gene silencing through the use of small interfering RNA (siRNA) has become a primary tool for identifying disease-causing genes. There are several aspects for preparing and delivering effective siRNA to knockdown a target gene. The length of siRNA should be 21–23nt long with G/C content 30–50%. If a validated siRNA sequence for your target gene is not available, use siRNA generated against the entire target gene ORF. Always work with two or three different siRNA constructs to get reliable results. If you are not sure how much siRNA to use for a given experiment, start with a transfection concentration of 10-50 nM and use siRNA-specific transfection reagent to ensure efficient siRNA delivery in a wide range of cells. 1 Matching solution Start a discussion Start discussion No discussions found Start your discussion Share your thoughts or question with experts in your field Start a discussion Found 1 matching solution for this experiment siRNA SKIL Thermo Fisher Scientific Upstream tips Protocol tips Downstream tips Seed 30000 cells/well The siRNA sequences (5′-to-3′) were: 1: GGCAAGUAAGUCCAUAUCATT (sense) and UGAUAUGGACUUGCCTC (antisense) 2: GGCUCACAGUAGUGGUAATT (sense) and UUACCACUACUGUGAGCCTT (antisense) siRNA concentration-50 nM Add INTERFERin® to siRNA duplexes and incubate for 10min at RT after homogenization.  Remove culture medium from cells and add incubate mixture.  Incubate the plate at 37°C for 24 to 72 h. Upstream tips Seed 30000 cells/well Protocol tips The siRNA sequences (5′-to-3′) were: 1: GGCAAGUAAGUCCAUAUCATT (sense) and UGAUAUGGACUUGCCTC (antisense) 2: GGCUCACAGUAGUGGUAATT (sense) and UUACCACUACUGUGAGCCTT (antisense) siRNA concentration-50 nM Add INTERFERin® to siRNA duplexes and incubate for 10min at RT after homogenization.  Remove culture medium from cells and add incubate mixture.  Incubate the plate at 37°C for 24 to 72 h. Manufacturer protocol Publication protocol 1 Relevant paper Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product! Become shareholder Discussions About us Contact Privacy Terms

RNA siRNA / miRNA gene silencing Human RWPE SKIL

Find the best product for any wet lab experiment Shared knowledge is peer reviewed Ask questions, get answers Toggle navigation Experiments Products Discussions   Login   Join for free Labettor RNA siRNA / miRNA gene silencing Human LNCap SKIL siRNA / miRNA gene silencing Human - LNCap SKIL Gene silencing through the use of small interfering RNA (siRNA) has become a primary tool for identifying disease-causing genes. There are several aspects for preparing and delivering effective siRNA to knockdown a target gene. The length of siRNA should be 21–23nt long with G/C content 30–50%. If a validated siRNA sequence for your target gene is not available, use siRNA generated against the entire target gene ORF. Always work with two or three different siRNA constructs to get reliable results. If you are not sure how much siRNA to use for a given experiment, start with a transfection concentration of 10-50 nM and use siRNA-specific transfection reagent to ensure efficient siRNA delivery in a wide range of cells. 1 Matching solution Start a discussion Start discussion No discussions found Start your discussion Share your thoughts or question with experts in your field Start a discussion Found 1 matching solution for this experiment siRNA SKIL Thermo Fisher Scientific Upstream tips Protocol tips Downstream tips The siRNA sequences (5′-to-3′) were: 1: GGCAAGUAAGUCCAUAUCATT (sense) and UGAUAUGGACUUGCCTC (antisense) 2: GGCUCACAGUAGUGGUAATT (sense) and UUACCACUACUGUGAGCCTT (antisense) SKIL siRNA concentration- 50 nM Add INTERFERin to siRNA duplexes and incubate for 10min at RT after homogenization. Remove culture medium from cells and add incubate mixture. Incubate the plate at 37°C for 24 to 72 h. Protocol tips The siRNA sequences (5′-to-3′) were: 1: GGCAAGUAAGUCCAUAUCATT (sense) and UGAUAUGGACUUGCCTC (antisense) 2: GGCUCACAGUAGUGGUAATT (sense) and UUACCACUACUGUGAGCCTT (antisense) SKIL siRNA concentration- 50 nM Add INTERFERin to siRNA duplexes and incubate for 10min at RT after homogenization. Remove culture medium from cells and add incubate mixture. Incubate the plate at 37°C for 24 to 72 h. Manufacturer protocol Publication protocol 1 Relevant paper Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product! Become shareholder Discussions About us Contact Privacy Terms

RNA siRNA / miRNA gene silencing Human LNCap SKIL

Find the best product for any wet lab experiment Shared knowledge is peer reviewed Ask questions, get answers Toggle navigation Experiments Products Discussions   Login   Join for free Labettor RNA siRNA / miRNA gene silencing Rat Astrocytes Nrf2 siRNA / miRNA gene silencing Rat - Astrocytes Nrf2 1 Matching solution Start a discussion Start discussion No discussions found Start your discussion Share your thoughts or question with experts in your field Start a discussion Found 1 matching solution for this experiment Nrf2 siRNA (r) Santa Cruz Biotechnology Upstream tips Protocol tips Downstream tips Add Solution A to Solution B and incubate for 15-45 minutes at room temperature. Add this mixture to cells and incubate for 5-7 hours at 37° C in a CO2 incubator. Add 1 ml of normal growth medium containing 2 times the normal serum and antibiotics concentration (2x normal growth medium) without removing the transfection mixture. Incubate the cells for an additional 18-24 hours. Protocol tips Add Solution A to Solution B and incubate for 15-45 minutes at room temperature. Add this mixture to cells and incubate for 5-7 hours at 37° C in a CO2 incubator. Add 1 ml of normal growth medium containing 2 times the normal serum and antibiotics concentration (2x normal growth medium) without removing the transfection mixture. Incubate the cells for an additional 18-24 hours. Manufacturer protocol Publication protocol 1 Relevant paper Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product! Become shareholder Discussions About us Contact Privacy Terms

RNA siRNA / miRNA gene silencing Rat Astrocytes Nrf2

Find the best product for any wet lab experiment Shared knowledge is peer reviewed Ask questions, get answers Toggle navigation Experiments Products Discussions   Login   Join for free Labettor RNA siRNA / miRNA gene silencing Human siRNA negative control Lipid siRNA / miRNA gene silencing Human - siRNA negative control Lipid 2 Matching solutions Start a discussion Start discussion No discussions found Start your discussion Share your thoughts or question with experts in your field Start a discussion Found 2 matching solutions for this experiment Lipofectamine® RNAiMAX Transfection Reagent Thermo Fisher Scientific Manufacturer protocol Silencer® Select Negative Control No 1 siRNA Thermo Fisher Scientific Manufacturer protocol Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product! Become shareholder Discussions About us Contact Privacy Terms

RNA siRNA / miRNA gene silencing Human siRNA negative control Lipid
Become shareholder Discussions About us Contact Privacy Terms