Chromatin Immunoprecipitation (ChIP) Assay Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	-Just because an antibody works well in a Western blot does not always indicate it will perform well in chromatin immunoprecipitation. Unlike a Western blot that detects proteins that have been denatured, a ChIP antibody must recognize the target protein in its native state. Use ChIP-validated antibody. -Use 2-10 μg of your ChIP antibody depending on the abundance of your protein target.

Protocol tips
-Just because an antibody works well in a Western blot does not always indicate it will perform well in chromatin immunoprecipitation. Unlike a Western blot that detects proteins that have been denatured, a ChIP antibody must recognize the target protein in its native state. Use ChIP-validated antibody. -Use 2-10 μg of your ChIP antibody depending on the abundance of your protein target.

Publication protocol

ChIP assays were performed by using a ChIP assay kit (Millipore Corporation, Billerica, MA, USA) according to the manufacturer's instructions. Soluble chromatin was prepared from HSCs treated with vehicle or GANT‐58 at 10 μM for 24 h and then were incubated with ChIP‐grade antibodies against Glli1 (Santa Cruz Biotechnology, CA, USA) or IgG. The immunoprecipitated DNA was amplified by the promoter‐specific primers: forward 5′‐GAAACGTGACTAACCGCACC‐3′, reverse 5′‐GAAGGTTCGGGAGGCTTCT‐3′. DNA enrichment was evaluated by average values of the eluate with immunoprecipitated DNA normalized to average values of input.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Mouse - HSC using Chromatin Immunoprecipitation (ChIP) Assay Kit from Merck Millipore.

Manufacturer protocol

Download the product protocol from Merck Millipore for Chromatin Immunoprecipitation (ChIP) Assay Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing ChIP Mouse - HSC using Chromatin Immunoprecipitation (ChIP) Assay Kit from Merck Millipore. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.