SacI (10 U/µL)

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Next, the generated PCR fragment was subjected to SacI digestion (Thermo Fisher Scientific) and then blunt-sticky end ligation with pNZ8150 cut previously with SacI/ScaI enzymes.

Protocol tips
Next, the generated PCR fragment was subjected to SacI digestion (Thermo Fisher Scientific) and then blunt-sticky end ligation with pNZ8150 cut previously with SacI/ScaI enzymes.

Publication protocol

Gene encoding the H5 nucleocapsid protein of the avian influenza virus H5N1 A/swan/Poland/305-135V08/2006 strain from AIV EpiFlu Database [http://platform.gisaid.org] (accession number: EP1156789) was commercially synthesized by GeneArt™. For stability, DNA fragment corresponding to the protein’s proteolytic cleavage site (ΔRRRKKR aa) was deleted from the original nucleotide sequence. For efficient translation and mRNA stability in L. lactis cells, codon optimization was performed by modifying the H5 nucleotide sequence using the GeneOptimizer® software. The codon-optimized H5 nucleotide sequence was amplified by PCR reaction using FHASnisScaI/RHASSacI (5′ ATGGAAAAAATTGTTCTT 3′/5′ GCCGAGCTCGTTAAATACAAATACG 3′) primers and Pfu DNA Polymerase (Thermo Fisher Scientific) generating blunt ends. The 5′ end of the reverse primer was adapted to contain the SacI restriction site (in bold). Next, the generated PCR fragment was subjected to SacI digestion (Thermo Fisher Scientific) and then blunt-sticky end ligation with pNZ8150 cut previously with SacI/ScaI enzymes. In effect, a translational fusion with the nisA promoter was obtained. The resulting recombinant plasmid was termed pNZ8150:H5 and introduced into L. lactis NZ9000 cells via electroporation.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes SacI using SacI (10 U/µL) from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for SacI (10 U/µL) below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Restriction Enzymes SacI using SacI (10 U/µL) from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.