Publication protocol
"For proof of principle modular assembly of ∼1 kb DNA
from 4 fragments by MetClo, assembly reactions were set
up using 60 fmol of each donor plasmid prepared from
normal DH10B cells, 60 fmol of assembly vector prepared
from DH10B strains stably expressing compatible methylase, 1,000 U T4 DNA ligase (NEB), and 5 U BsaI (NEB)
or BpiI (Thermo Fisher Scientific) or 2.5 U LguI (Thermo
Fisher Scientific) in 20 l 1× T4 ligase buffer (NEB). The
reaction condition was: 37◦C 15 min, followed by 45 cycles
of 37◦C 2 min plus 16◦C 5 min, then 37◦C 20 min, and 80◦C
5 min. Assembly reactions were transformed into normal
DH10B chemical competent cells, and plated on LB plates
with AIX selection (ampicillin 100 g/ml, IPTG 100 M,
X-gal 50 g/ml) at 37◦C overnight. White colonies were expanded and screened by restriction digestion using the corresponding restriction enzyme and by DNA sequencing.
For hierarchical assembly of a 218 kb DNA from 28
fragments by MetClo, the assembly was carried out in two
stages. In stage one, the fragments were assembled, seven
per group, using 15 fmol of each donor plasmid prepared
from DH10B cells, 15 fmol assembly vector prepared from
DH10B-M.Osp807II cells, 1000 U T4 ligase (NEB), and 5
U BsaI (NEB) in 20 l 1× T4 ligase buffer (NEB). The reaction condition was the same as described above. The assembled samples were then drop-dialyzed against 50 ml dH2O
using 0.05 m mixed cellulose esters membrane discs (Millipore) at room temperature for 1 h. 5 l of the dialyzed sample was transformed into 25 l NEB 10-beta electrocompetent cells (NEB) by electroporation at 0.9 kV 100 25
F using a Gene Pulser and 1 mm electroporation cuvettes(Bio-Rad). Following electroporation, 1 ml LB medium was
added to the cells and incubated at 37◦C 220 rpm for 1 h.
Cells were plated on LB plates with GIX selection (gentamicin 2.5 g/ml, IPTG 100 M, X-gal 50 g/ml) at 37◦C
overnight. Four white colonies were expanded and screened
by restriction digestion using XhoI (NEB).
In stage two, the 218 kb DNA was assembled using protocols similar to stage one with the following modifications. 30 fmol of each donor plasmid and 15 fmol assembly vector were used in the assembly reaction. Following
modular assembly and before the drop dialysis step, 10
U BsaI was added to the assembly reaction for incubation at 37◦C for 45 min followed by heat inactivation at
80◦C for 5 min. Transformed cells were plated on LB plates
with KIX selection (kanamycin 30 g/ml, IPTG 100 M,
X-gal 50 g/ml). A total of 27 white colonies from two
transformations were screened by PCR using primers detecting the junction between the second and the third 54
kb fragments (TACCCACGTGATTCACGCTG and AT
CCTACAGACTCGCTGTGG). A subset of PCR-positive
clones were screened by restriction digest using XhoI with
standard agarose gel electrophoresis, and BsaI with pulsedfield electrophoresis using the CHEF II system (Bio-Rad).
The same set of 28 insert plasmids from the stage one
MetClo assembly were assembled in sets of seven per group
using MoClo vectors to compare the performance of MetClo with MoClo. The MoClo assembly was undertaken
using a protocol analogous to the MetClo protocol described above, but with 15 fmol MoClo assembly vector prepared from DH10B cells in the one-pot assembly reaction.
Six white colonies from each assembly were expanded and
screened by restriction digest using XhoI."
Full paper
Login or
join for free to view the full paper.