SnaBI restriction enzyme

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	The fusion gene was then amplified from the ligation product by PCR using primers bg-SnaBI-F and eg-Eco81I-R, digested with SnaBI and Eco81I (TaKaRa, Dalian, China), and then cloned into pHBM368-pgk to generate plasmid pHBM368-pgk-bce. The resulting vector was sequenced by TsingKe Biological Technology Company (Wuhan, China).

Protocol tips
The fusion gene was then amplified from the ligation product by PCR using primers bg-SnaBI-F and eg-Eco81I-R, digested with SnaBI and Eco81I (TaKaRa, Dalian, China), and then cloned into pHBM368-pgk to generate plasmid pHBM368-pgk-bce. The resulting vector was sequenced by TsingKe Biological Technology Company (Wuhan, China).

Publication protocol

"The strategy used to construct a trifunctional single gene described in this work is depicted in Fig. 1. The DNA fragment encoding the bg gene was amplified from pHBM368-pgk-bg by PCR using primers bg-SnaBI-F (5′-ATGTACGTAAGTAATCCGTTCCCCGAC) and bg-L-XbaI-R (5′-ATCTAGACGAGCCACCGCCACCCGACCCACCACCGCCCGAGCCACCGCCACCCCCCAGGCACGCCCCATT) which contain restriction sites (shown in bold) for SnaBI and XbaI, respectively. The amplicon represents the sequences that encoded the mature BG catalytic domain without the translation start codon or the translation stop codon. A glycine-serine linker, was used as a flexible linker for the construction of fusion protein in the construct: GGGGSGGGGSGGGGS [named (G4S)3] [29], the reverse coding sequences (underlined in the primer sequence) of which were added in via the bg-L-XbaI-R primer. The DNA fragment encoding the cbh gene was amplified from pHBM368-pgk-cbh by PCR using primers cbh-XbaI-F (5′-ACTTCTAGACAGGGAAATCAGGATTTC) and cbh-L-EcoRI-R (5′-AGAATTCCGAGCCACCGCCACCCGACCCACCACCGCCCGAGCCACCGCCACCATAAGTGCTATCAATCGGA) which contain restriction sites (shown in bold) for XbaI and EcoRI, respectively. The amplicon represents the sequences that encode the mature CBH catalytic domain without its native signal peptide, the translation start codon or the translation stop codon. The reverse coding sequences of (G4S)3 (underlined in the primer sequence) were added in cbh-L-EcoRI-R. The DNA fragment encoding the eg gene was amplified from pHBM368-pgk-eg by PCR using primers eg-EcoRI-F (5′-ATCGAATTCCAGTCGCTTTGCGACCAAT) and eg-Eco81I-R (5′-ACTCCTGAGGCTAGTTGTTTTGTTGGGCGGA) which contain restriction sites (shown in bold) for EcoRI and Eco81I, respectively. The amplicon represents the sequences that encode the mature EG catalytic domain without its native signal peptide or the translation start codon.

Three amplified cellulase DNA products were ligated together using T4 DNA ligase (TaKaRa, Dalian, China) as per manufacturer’s instructions. The fusion gene was then amplified from the ligation product by PCR using primers bg-SnaBI-F and eg-Eco81I-R, digested with SnaBI and Eco81I (TaKaRa, Dalian, China), and then cloned into pHBM368-pgk to generate plasmid pHBM368-pgk-bce. The resulting vector was sequenced by TsingKe Biological Technology Company (Wuhan, China)."

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Restriction Enzymes SnaBI / Eco105I using SnaBI restriction enzyme from Takara Bio Inc.

Manufacturer protocol

Download the product protocol from Takara Bio Inc for SnaBI restriction enzyme below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Restriction Enzymes SnaBI / Eco105I using SnaBI restriction enzyme from Takara Bio Inc. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.